ID: 1110960105

View in Genome Browser
Species Human (GRCh38)
Location 13:81610618-81610640
Sequence ATGCCCTTCTAAAAAAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110960105_1110960107 2 Left 1110960105 13:81610618-81610640 CCTTCACTTTTTTAGAAGGGCAT No data
Right 1110960107 13:81610643-81610665 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254
1110960105_1110960108 7 Left 1110960105 13:81610618-81610640 CCTTCACTTTTTTAGAAGGGCAT No data
Right 1110960108 13:81610648-81610670 TAGGTCCTTTTTCCATGGTTTGG 0: 14
1: 15
2: 18
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110960105 Original CRISPR ATGCCCTTCTAAAAAAGTGA AGG (reversed) Intergenic
No off target data available for this crispr