ID: 1110968689

View in Genome Browser
Species Human (GRCh38)
Location 13:81733369-81733391
Sequence GAGGGTGAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110968689_1110968696 24 Left 1110968689 13:81733369-81733391 CCATCCTGCTTCTGCTCACCCTC No data
Right 1110968696 13:81733416-81733438 CAATCCCAGTGAAATGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110968689 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr