ID: 1110972907

View in Genome Browser
Species Human (GRCh38)
Location 13:81788854-81788876
Sequence AGTCATTTGCAGAACGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110972907_1110972909 -1 Left 1110972907 13:81788854-81788876 CCATCCACGTTCTGCAAATGACT No data
Right 1110972909 13:81788876-81788898 TGAATCTTATTATTTTTTTATGG No data
1110972907_1110972910 29 Left 1110972907 13:81788854-81788876 CCATCCACGTTCTGCAAATGACT No data
Right 1110972910 13:81788906-81788928 GTACTCTATTAAGTATATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110972907 Original CRISPR AGTCATTTGCAGAACGTGGA TGG (reversed) Intergenic
No off target data available for this crispr