ID: 1110973987

View in Genome Browser
Species Human (GRCh38)
Location 13:81806263-81806285
Sequence GAGCAGTATTGCCACAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110973983_1110973987 15 Left 1110973983 13:81806225-81806247 CCTGAGCAGCAAGAATCACAGGC No data
Right 1110973987 13:81806263-81806285 GAGCAGTATTGCCACAAAGAGGG No data
1110973981_1110973987 16 Left 1110973981 13:81806224-81806246 CCCTGAGCAGCAAGAATCACAGG No data
Right 1110973987 13:81806263-81806285 GAGCAGTATTGCCACAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110973987 Original CRISPR GAGCAGTATTGCCACAAAGA GGG Intergenic
No off target data available for this crispr