ID: 1110974777

View in Genome Browser
Species Human (GRCh38)
Location 13:81817164-81817186
Sequence CTAAGATTTTTACAGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110974777_1110974781 17 Left 1110974777 13:81817164-81817186 CCCTCAAACTGTAAAAATCTTAG No data
Right 1110974781 13:81817204-81817226 ACCATTCTGGACATCAGCCTTGG 0: 71
1: 149
2: 356
3: 985
4: 16200
1110974777_1110974779 4 Left 1110974777 13:81817164-81817186 CCCTCAAACTGTAAAAATCTTAG No data
Right 1110974779 13:81817191-81817213 AAACCTAGAAAACACCATTCTGG 0: 20
1: 197
2: 995
3: 10446
4: 12842

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110974777 Original CRISPR CTAAGATTTTTACAGTTTGA GGG (reversed) Intergenic
No off target data available for this crispr