ID: 1110977030

View in Genome Browser
Species Human (GRCh38)
Location 13:81851420-81851442
Sequence TAAGGAAAACAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110977026_1110977030 17 Left 1110977026 13:81851380-81851402 CCTAGACTGTTCATAGATTGAAA No data
Right 1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110977030 Original CRISPR TAAGGAAAACAGAAGGAAGA AGG Intergenic
No off target data available for this crispr