ID: 1110981665

View in Genome Browser
Species Human (GRCh38)
Location 13:81908203-81908225
Sequence ATGTACATTCAGATAAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110981665_1110981670 -4 Left 1110981665 13:81908203-81908225 CCCCACCTTATCTGAATGTACAT No data
Right 1110981670 13:81908222-81908244 ACATTCTAGTGAGGCAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110981665 Original CRISPR ATGTACATTCAGATAAGGTG GGG (reversed) Intergenic
No off target data available for this crispr