ID: 1110987077

View in Genome Browser
Species Human (GRCh38)
Location 13:81984444-81984466
Sequence TAGCAAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110987072_1110987077 19 Left 1110987072 13:81984402-81984424 CCGGATCTGGAGGGATGGAAGTC 0: 29
1: 69
2: 102
3: 85
4: 220
Right 1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG No data
1110987071_1110987077 23 Left 1110987071 13:81984398-81984420 CCTGCCGGATCTGGAGGGATGGA No data
Right 1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG No data
1110987069_1110987077 24 Left 1110987069 13:81984397-81984419 CCCTGCCGGATCTGGAGGGATGG 0: 14
1: 66
2: 136
3: 139
4: 219
Right 1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110987077 Original CRISPR TAGCAAACAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr