ID: 1110988941

View in Genome Browser
Species Human (GRCh38)
Location 13:82012320-82012342
Sequence TGTGGATAATTTACACTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110988934_1110988941 20 Left 1110988934 13:82012277-82012299 CCTTATTTTTCCTCCACTCCCTA No data
Right 1110988941 13:82012320-82012342 TGTGGATAATTTACACTTGAGGG No data
1110988937_1110988941 2 Left 1110988937 13:82012295-82012317 CCCTAAATATGCTTTTGCAATTT No data
Right 1110988941 13:82012320-82012342 TGTGGATAATTTACACTTGAGGG No data
1110988936_1110988941 7 Left 1110988936 13:82012290-82012312 CCACTCCCTAAATATGCTTTTGC No data
Right 1110988941 13:82012320-82012342 TGTGGATAATTTACACTTGAGGG No data
1110988935_1110988941 10 Left 1110988935 13:82012287-82012309 CCTCCACTCCCTAAATATGCTTT No data
Right 1110988941 13:82012320-82012342 TGTGGATAATTTACACTTGAGGG No data
1110988938_1110988941 1 Left 1110988938 13:82012296-82012318 CCTAAATATGCTTTTGCAATTTT No data
Right 1110988941 13:82012320-82012342 TGTGGATAATTTACACTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110988941 Original CRISPR TGTGGATAATTTACACTTGA GGG Intergenic