ID: 1110993399

View in Genome Browser
Species Human (GRCh38)
Location 13:82072476-82072498
Sequence CTGCCTCTTACTGTGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110993399_1110993404 25 Left 1110993399 13:82072476-82072498 CCAGCATTCACAGTAAGAGGCAG No data
Right 1110993404 13:82072524-82072546 ATCTTCCTCTAGGAACATATGGG No data
1110993399_1110993403 24 Left 1110993399 13:82072476-82072498 CCAGCATTCACAGTAAGAGGCAG No data
Right 1110993403 13:82072523-82072545 TATCTTCCTCTAGGAACATATGG No data
1110993399_1110993402 15 Left 1110993399 13:82072476-82072498 CCAGCATTCACAGTAAGAGGCAG No data
Right 1110993402 13:82072514-82072536 CTTGTATATTATCTTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110993399 Original CRISPR CTGCCTCTTACTGTGAATGC TGG (reversed) Intergenic
No off target data available for this crispr