ID: 1110993892

View in Genome Browser
Species Human (GRCh38)
Location 13:82079781-82079803
Sequence GGAGTTCAGCAGTCTTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110993892_1110993899 25 Left 1110993892 13:82079781-82079803 CCTACAGAAGACTGCTGAACTCC No data
Right 1110993899 13:82079829-82079851 AAGGGAAATATTACGTCAGGTGG No data
1110993892_1110993900 26 Left 1110993892 13:82079781-82079803 CCTACAGAAGACTGCTGAACTCC No data
Right 1110993900 13:82079830-82079852 AGGGAAATATTACGTCAGGTGGG No data
1110993892_1110993898 22 Left 1110993892 13:82079781-82079803 CCTACAGAAGACTGCTGAACTCC No data
Right 1110993898 13:82079826-82079848 AAAAAGGGAAATATTACGTCAGG No data
1110993892_1110993896 6 Left 1110993892 13:82079781-82079803 CCTACAGAAGACTGCTGAACTCC No data
Right 1110993896 13:82079810-82079832 TGGACTTGATCAGCAAAAAAAGG No data
1110993892_1110993897 7 Left 1110993892 13:82079781-82079803 CCTACAGAAGACTGCTGAACTCC No data
Right 1110993897 13:82079811-82079833 GGACTTGATCAGCAAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110993892 Original CRISPR GGAGTTCAGCAGTCTTCTGT AGG (reversed) Intergenic
No off target data available for this crispr