ID: 1110998550

View in Genome Browser
Species Human (GRCh38)
Location 13:82145966-82145988
Sequence CTTCTCGAGGCCAAAATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110998547_1110998550 8 Left 1110998547 13:82145935-82145957 CCTATCTGCATTTTTCTCTCCAA No data
Right 1110998550 13:82145966-82145988 CTTCTCGAGGCCAAAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110998550 Original CRISPR CTTCTCGAGGCCAAAATAAT TGG Intergenic
No off target data available for this crispr