ID: 1110999960

View in Genome Browser
Species Human (GRCh38)
Location 13:82165669-82165691
Sequence GGCAGCGGGAGGCAAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110999960_1110999965 -8 Left 1110999960 13:82165669-82165691 CCAGGACTTTGCCTCCCGCTGCC No data
Right 1110999965 13:82165684-82165706 CCGCTGCCATTCATGGCCCCAGG No data
1110999960_1110999973 25 Left 1110999960 13:82165669-82165691 CCAGGACTTTGCCTCCCGCTGCC No data
Right 1110999973 13:82165717-82165739 AACCCTGCTCTTGAGATTAAAGG No data
1110999960_1110999974 26 Left 1110999960 13:82165669-82165691 CCAGGACTTTGCCTCCCGCTGCC No data
Right 1110999974 13:82165718-82165740 ACCCTGCTCTTGAGATTAAAGGG No data
1110999960_1110999968 -2 Left 1110999960 13:82165669-82165691 CCAGGACTTTGCCTCCCGCTGCC No data
Right 1110999968 13:82165690-82165712 CCATTCATGGCCCCAGGGCTTGG No data
1110999960_1110999966 -7 Left 1110999960 13:82165669-82165691 CCAGGACTTTGCCTCCCGCTGCC No data
Right 1110999966 13:82165685-82165707 CGCTGCCATTCATGGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110999960 Original CRISPR GGCAGCGGGAGGCAAAGTCC TGG (reversed) Intergenic
No off target data available for this crispr