ID: 1111000001

View in Genome Browser
Species Human (GRCh38)
Location 13:82165836-82165858
Sequence CAGCTGCAAGATGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110999989_1111000001 20 Left 1110999989 13:82165793-82165815 CCCGCTTGTCCCCAGCTCCTAGT No data
Right 1111000001 13:82165836-82165858 CAGCTGCAAGATGCCCTGGGAGG No data
1110999994_1111000001 9 Left 1110999994 13:82165804-82165826 CCAGCTCCTAGTGAGTCAGAGGC No data
Right 1111000001 13:82165836-82165858 CAGCTGCAAGATGCCCTGGGAGG No data
1110999996_1111000001 3 Left 1110999996 13:82165810-82165832 CCTAGTGAGTCAGAGGCCCAGGT No data
Right 1111000001 13:82165836-82165858 CAGCTGCAAGATGCCCTGGGAGG No data
1110999992_1111000001 10 Left 1110999992 13:82165803-82165825 CCCAGCTCCTAGTGAGTCAGAGG No data
Right 1111000001 13:82165836-82165858 CAGCTGCAAGATGCCCTGGGAGG No data
1110999991_1111000001 11 Left 1110999991 13:82165802-82165824 CCCCAGCTCCTAGTGAGTCAGAG No data
Right 1111000001 13:82165836-82165858 CAGCTGCAAGATGCCCTGGGAGG No data
1110999990_1111000001 19 Left 1110999990 13:82165794-82165816 CCGCTTGTCCCCAGCTCCTAGTG No data
Right 1111000001 13:82165836-82165858 CAGCTGCAAGATGCCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111000001 Original CRISPR CAGCTGCAAGATGCCCTGGG AGG Intergenic
No off target data available for this crispr