ID: 1111005883

View in Genome Browser
Species Human (GRCh38)
Location 13:82248246-82248268
Sequence ATGTTAACTCACATGACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111005883_1111005887 17 Left 1111005883 13:82248246-82248268 CCTTGTGTCATGTGAGTTAACAT No data
Right 1111005887 13:82248286-82248308 ATTAGTATGTCGTCATTATCGGG No data
1111005883_1111005886 16 Left 1111005883 13:82248246-82248268 CCTTGTGTCATGTGAGTTAACAT No data
Right 1111005886 13:82248285-82248307 GATTAGTATGTCGTCATTATCGG No data
1111005883_1111005888 18 Left 1111005883 13:82248246-82248268 CCTTGTGTCATGTGAGTTAACAT No data
Right 1111005888 13:82248287-82248309 TTAGTATGTCGTCATTATCGGGG No data
1111005883_1111005889 19 Left 1111005883 13:82248246-82248268 CCTTGTGTCATGTGAGTTAACAT No data
Right 1111005889 13:82248288-82248310 TAGTATGTCGTCATTATCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111005883 Original CRISPR ATGTTAACTCACATGACACA AGG (reversed) Intergenic
No off target data available for this crispr