ID: 1111006712

View in Genome Browser
Species Human (GRCh38)
Location 13:82258335-82258357
Sequence AGGAGTGTGGTGCACCGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111006699_1111006712 22 Left 1111006699 13:82258290-82258312 CCCCCTGCTCCAGGGCGCTCGGT No data
Right 1111006712 13:82258335-82258357 AGGAGTGTGGTGCACCGCACGGG No data
1111006702_1111006712 19 Left 1111006702 13:82258293-82258315 CCTGCTCCAGGGCGCTCGGTCTC No data
Right 1111006712 13:82258335-82258357 AGGAGTGTGGTGCACCGCACGGG No data
1111006700_1111006712 21 Left 1111006700 13:82258291-82258313 CCCCTGCTCCAGGGCGCTCGGTC No data
Right 1111006712 13:82258335-82258357 AGGAGTGTGGTGCACCGCACGGG No data
1111006707_1111006712 -9 Left 1111006707 13:82258321-82258343 CCGCCCAAGGGCTGAGGAGTGTG 0: 169
1: 616
2: 774
3: 321
4: 293
Right 1111006712 13:82258335-82258357 AGGAGTGTGGTGCACCGCACGGG No data
1111006701_1111006712 20 Left 1111006701 13:82258292-82258314 CCCTGCTCCAGGGCGCTCGGTCT No data
Right 1111006712 13:82258335-82258357 AGGAGTGTGGTGCACCGCACGGG No data
1111006703_1111006712 13 Left 1111006703 13:82258299-82258321 CCAGGGCGCTCGGTCTCATCAAC No data
Right 1111006712 13:82258335-82258357 AGGAGTGTGGTGCACCGCACGGG No data
1111006697_1111006712 25 Left 1111006697 13:82258287-82258309 CCGCCCCCTGCTCCAGGGCGCTC No data
Right 1111006712 13:82258335-82258357 AGGAGTGTGGTGCACCGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111006712 Original CRISPR AGGAGTGTGGTGCACCGCAC GGG Intergenic
No off target data available for this crispr