ID: 1111007238

View in Genome Browser
Species Human (GRCh38)
Location 13:82263854-82263876
Sequence ATCTTAAAGCTAATGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111007238_1111007243 14 Left 1111007238 13:82263854-82263876 CCAAACTGCATTAGCTTTAAGAT No data
Right 1111007243 13:82263891-82263913 CAGGATATAGCAATTGAGAAGGG No data
1111007238_1111007245 24 Left 1111007238 13:82263854-82263876 CCAAACTGCATTAGCTTTAAGAT No data
Right 1111007245 13:82263901-82263923 CAATTGAGAAGGGCATGAGGAGG No data
1111007238_1111007244 21 Left 1111007238 13:82263854-82263876 CCAAACTGCATTAGCTTTAAGAT No data
Right 1111007244 13:82263898-82263920 TAGCAATTGAGAAGGGCATGAGG No data
1111007238_1111007241 -5 Left 1111007238 13:82263854-82263876 CCAAACTGCATTAGCTTTAAGAT No data
Right 1111007241 13:82263872-82263894 AAGATTGTCAGGGAGAAGTCAGG No data
1111007238_1111007242 13 Left 1111007238 13:82263854-82263876 CCAAACTGCATTAGCTTTAAGAT No data
Right 1111007242 13:82263890-82263912 TCAGGATATAGCAATTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111007238 Original CRISPR ATCTTAAAGCTAATGCAGTT TGG (reversed) Intergenic
No off target data available for this crispr