ID: 1111007976

View in Genome Browser
Species Human (GRCh38)
Location 13:82275006-82275028
Sequence ACTGAGCTCTATTTCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111007976_1111007978 4 Left 1111007976 13:82275006-82275028 CCAGCTTTGAAATAGAGCTCAGT No data
Right 1111007978 13:82275033-82275055 TGAATTGGTCAATTATAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111007976 Original CRISPR ACTGAGCTCTATTTCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr