ID: 1111010705

View in Genome Browser
Species Human (GRCh38)
Location 13:82310514-82310536
Sequence GTGTGCACAAAAGCTCTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111010705_1111010706 -3 Left 1111010705 13:82310514-82310536 CCTATGAGAGCTTTTGTGCACAC No data
Right 1111010706 13:82310534-82310556 CACTTTGCCCAGCAAAGCCATGG No data
1111010705_1111010711 23 Left 1111010705 13:82310514-82310536 CCTATGAGAGCTTTTGTGCACAC No data
Right 1111010711 13:82310560-82310582 CATGGCTGTCCAAGACTTTAAGG No data
1111010705_1111010709 5 Left 1111010705 13:82310514-82310536 CCTATGAGAGCTTTTGTGCACAC No data
Right 1111010709 13:82310542-82310564 CCAGCAAAGCCATGGTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111010705 Original CRISPR GTGTGCACAAAAGCTCTCAT AGG (reversed) Intergenic
No off target data available for this crispr