ID: 1111021439

View in Genome Browser
Species Human (GRCh38)
Location 13:82457681-82457703
Sequence AGGCAAACAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111021439_1111021449 23 Left 1111021439 13:82457681-82457703 CCATCCACCACTGCTGTTTGCCT No data
Right 1111021449 13:82457727-82457749 CCCATCCCTCCGGATCCGGCAGG No data
1111021439_1111021447 19 Left 1111021439 13:82457681-82457703 CCATCCACCACTGCTGTTTGCCT No data
Right 1111021447 13:82457723-82457745 GACTCCCATCCCTCCGGATCCGG No data
1111021439_1111021445 13 Left 1111021439 13:82457681-82457703 CCATCCACCACTGCTGTTTGCCT No data
Right 1111021445 13:82457717-82457739 ACCACTGACTCCCATCCCTCCGG 0: 3
1: 6
2: 52
3: 132
4: 302
1111021439_1111021451 24 Left 1111021439 13:82457681-82457703 CCATCCACCACTGCTGTTTGCCT No data
Right 1111021451 13:82457728-82457750 CCATCCCTCCGGATCCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111021439 Original CRISPR AGGCAAACAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr