ID: 1111034961

View in Genome Browser
Species Human (GRCh38)
Location 13:82659983-82660005
Sequence GAGTTTCCTTGACCCCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111034961_1111034965 18 Left 1111034961 13:82659983-82660005 CCCACAAGGGGTCAAGGAAACTC No data
Right 1111034965 13:82660024-82660046 CAGAACATATGCCATTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111034961 Original CRISPR GAGTTTCCTTGACCCCTTGT GGG (reversed) Intergenic
No off target data available for this crispr