ID: 1111039734

View in Genome Browser
Species Human (GRCh38)
Location 13:82731046-82731068
Sequence TTGAATAAACCTGAGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111039734_1111039737 15 Left 1111039734 13:82731046-82731068 CCATTGTCCTCAGGTTTATTCAA No data
Right 1111039737 13:82731084-82731106 TGAAGACTTGACTCCCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111039734 Original CRISPR TTGAATAAACCTGAGGACAA TGG (reversed) Intergenic
No off target data available for this crispr