ID: 1111046478

View in Genome Browser
Species Human (GRCh38)
Location 13:82820467-82820489
Sequence GTTGCAGGGAACCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111046478_1111046481 -7 Left 1111046478 13:82820467-82820489 CCAGCACAGTGGTTCCCTGCAAC No data
Right 1111046481 13:82820483-82820505 CTGCAACCCTTTCTTGTTCCAGG No data
1111046478_1111046488 24 Left 1111046478 13:82820467-82820489 CCAGCACAGTGGTTCCCTGCAAC No data
Right 1111046488 13:82820514-82820536 GCATATACTCCAGGGTTAGATGG No data
1111046478_1111046487 16 Left 1111046478 13:82820467-82820489 CCAGCACAGTGGTTCCCTGCAAC No data
Right 1111046487 13:82820506-82820528 AAGACTTGGCATATACTCCAGGG No data
1111046478_1111046484 2 Left 1111046478 13:82820467-82820489 CCAGCACAGTGGTTCCCTGCAAC No data
Right 1111046484 13:82820492-82820514 TTTCTTGTTCCAGGAAGACTTGG No data
1111046478_1111046486 15 Left 1111046478 13:82820467-82820489 CCAGCACAGTGGTTCCCTGCAAC No data
Right 1111046486 13:82820505-82820527 GAAGACTTGGCATATACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111046478 Original CRISPR GTTGCAGGGAACCACTGTGC TGG (reversed) Intergenic
No off target data available for this crispr