ID: 1111046481

View in Genome Browser
Species Human (GRCh38)
Location 13:82820483-82820505
Sequence CTGCAACCCTTTCTTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111046475_1111046481 27 Left 1111046475 13:82820433-82820455 CCTGCTTCTAGAGTACTCTCTTC No data
Right 1111046481 13:82820483-82820505 CTGCAACCCTTTCTTGTTCCAGG No data
1111046477_1111046481 -6 Left 1111046477 13:82820466-82820488 CCCAGCACAGTGGTTCCCTGCAA No data
Right 1111046481 13:82820483-82820505 CTGCAACCCTTTCTTGTTCCAGG No data
1111046478_1111046481 -7 Left 1111046478 13:82820467-82820489 CCAGCACAGTGGTTCCCTGCAAC No data
Right 1111046481 13:82820483-82820505 CTGCAACCCTTTCTTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111046481 Original CRISPR CTGCAACCCTTTCTTGTTCC AGG Intergenic
No off target data available for this crispr