ID: 1111046488

View in Genome Browser
Species Human (GRCh38)
Location 13:82820514-82820536
Sequence GCATATACTCCAGGGTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111046479_1111046488 10 Left 1111046479 13:82820481-82820503 CCCTGCAACCCTTTCTTGTTCCA No data
Right 1111046488 13:82820514-82820536 GCATATACTCCAGGGTTAGATGG No data
1111046480_1111046488 9 Left 1111046480 13:82820482-82820504 CCTGCAACCCTTTCTTGTTCCAG No data
Right 1111046488 13:82820514-82820536 GCATATACTCCAGGGTTAGATGG No data
1111046482_1111046488 2 Left 1111046482 13:82820489-82820511 CCCTTTCTTGTTCCAGGAAGACT No data
Right 1111046488 13:82820514-82820536 GCATATACTCCAGGGTTAGATGG No data
1111046483_1111046488 1 Left 1111046483 13:82820490-82820512 CCTTTCTTGTTCCAGGAAGACTT No data
Right 1111046488 13:82820514-82820536 GCATATACTCCAGGGTTAGATGG No data
1111046477_1111046488 25 Left 1111046477 13:82820466-82820488 CCCAGCACAGTGGTTCCCTGCAA No data
Right 1111046488 13:82820514-82820536 GCATATACTCCAGGGTTAGATGG No data
1111046478_1111046488 24 Left 1111046478 13:82820467-82820489 CCAGCACAGTGGTTCCCTGCAAC No data
Right 1111046488 13:82820514-82820536 GCATATACTCCAGGGTTAGATGG No data
1111046485_1111046488 -10 Left 1111046485 13:82820501-82820523 CCAGGAAGACTTGGCATATACTC No data
Right 1111046488 13:82820514-82820536 GCATATACTCCAGGGTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111046488 Original CRISPR GCATATACTCCAGGGTTAGA TGG Intergenic
No off target data available for this crispr