ID: 1111047655

View in Genome Browser
Species Human (GRCh38)
Location 13:82835670-82835692
Sequence ATTTTTTTAGAGATGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111047655_1111047659 7 Left 1111047655 13:82835670-82835692 CCAGACTCCATCTCTAAAAAAAT No data
Right 1111047659 13:82835700-82835722 CAGGCATAACAGCCCATGCCTGG No data
1111047655_1111047660 16 Left 1111047655 13:82835670-82835692 CCAGACTCCATCTCTAAAAAAAT No data
Right 1111047660 13:82835709-82835731 CAGCCCATGCCTGGAGTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111047655 Original CRISPR ATTTTTTTAGAGATGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr