ID: 1111052751

View in Genome Browser
Species Human (GRCh38)
Location 13:82906693-82906715
Sequence AGGCAGGTCTTCAGCCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111052746_1111052751 13 Left 1111052746 13:82906657-82906679 CCATATCTCAGTCTTCTGTTTTT No data
Right 1111052751 13:82906693-82906715 AGGCAGGTCTTCAGCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111052751 Original CRISPR AGGCAGGTCTTCAGCCACTG AGG Intergenic
No off target data available for this crispr