ID: 1111055070

View in Genome Browser
Species Human (GRCh38)
Location 13:82938422-82938444
Sequence AGAGAGGTAGCAAGGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111055070_1111055078 25 Left 1111055070 13:82938422-82938444 CCTCTCCACCTTGCTACCTCTCT No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data
1111055070_1111055075 6 Left 1111055070 13:82938422-82938444 CCTCTCCACCTTGCTACCTCTCT No data
Right 1111055075 13:82938451-82938473 CTGCCTAACCTCATTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111055070 Original CRISPR AGAGAGGTAGCAAGGTGGAG AGG (reversed) Intergenic
No off target data available for this crispr