ID: 1111055072

View in Genome Browser
Species Human (GRCh38)
Location 13:82938427-82938449
Sequence CAACCAGAGAGGTAGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111055072_1111055078 20 Left 1111055072 13:82938427-82938449 CCACCTTGCTACCTCTCTGGTTG No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data
1111055072_1111055075 1 Left 1111055072 13:82938427-82938449 CCACCTTGCTACCTCTCTGGTTG No data
Right 1111055075 13:82938451-82938473 CTGCCTAACCTCATTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111055072 Original CRISPR CAACCAGAGAGGTAGCAAGG TGG (reversed) Intergenic
No off target data available for this crispr