ID: 1111055073

View in Genome Browser
Species Human (GRCh38)
Location 13:82938430-82938452
Sequence AGACAACCAGAGAGGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111055073_1111055078 17 Left 1111055073 13:82938430-82938452 CCTTGCTACCTCTCTGGTTGTCT No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data
1111055073_1111055075 -2 Left 1111055073 13:82938430-82938452 CCTTGCTACCTCTCTGGTTGTCT No data
Right 1111055075 13:82938451-82938473 CTGCCTAACCTCATTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111055073 Original CRISPR AGACAACCAGAGAGGTAGCA AGG (reversed) Intergenic
No off target data available for this crispr