ID: 1111055074

View in Genome Browser
Species Human (GRCh38)
Location 13:82938438-82938460
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111055074_1111055075 -10 Left 1111055074 13:82938438-82938460 CCTCTCTGGTTGTCTGCCTAACC No data
Right 1111055075 13:82938451-82938473 CTGCCTAACCTCATTCTTCTTGG No data
1111055074_1111055079 23 Left 1111055074 13:82938438-82938460 CCTCTCTGGTTGTCTGCCTAACC No data
Right 1111055079 13:82938484-82938506 AGAACATGGAACCTGAACAGTGG No data
1111055074_1111055078 9 Left 1111055074 13:82938438-82938460 CCTCTCTGGTTGTCTGCCTAACC No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data
1111055074_1111055080 24 Left 1111055074 13:82938438-82938460 CCTCTCTGGTTGTCTGCCTAACC No data
Right 1111055080 13:82938485-82938507 GAACATGGAACCTGAACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111055074 Original CRISPR GGTTAGGCAGACAACCAGAG AGG (reversed) Intergenic
No off target data available for this crispr