ID: 1111055076

View in Genome Browser
Species Human (GRCh38)
Location 13:82938454-82938476
Sequence CATCCAAGAAGAATGAGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111055076_1111055081 17 Left 1111055076 13:82938454-82938476 CCTAACCTCATTCTTCTTGGATG No data
Right 1111055081 13:82938494-82938516 ACCTGAACAGTGGGTGTGAAAGG No data
1111055076_1111055078 -7 Left 1111055076 13:82938454-82938476 CCTAACCTCATTCTTCTTGGATG No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data
1111055076_1111055079 7 Left 1111055076 13:82938454-82938476 CCTAACCTCATTCTTCTTGGATG No data
Right 1111055079 13:82938484-82938506 AGAACATGGAACCTGAACAGTGG No data
1111055076_1111055080 8 Left 1111055076 13:82938454-82938476 CCTAACCTCATTCTTCTTGGATG No data
Right 1111055080 13:82938485-82938507 GAACATGGAACCTGAACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111055076 Original CRISPR CATCCAAGAAGAATGAGGTT AGG (reversed) Intergenic
No off target data available for this crispr