ID: 1111055078

View in Genome Browser
Species Human (GRCh38)
Location 13:82938470-82938492
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111055070_1111055078 25 Left 1111055070 13:82938422-82938444 CCTCTCCACCTTGCTACCTCTCT No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data
1111055076_1111055078 -7 Left 1111055076 13:82938454-82938476 CCTAACCTCATTCTTCTTGGATG No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data
1111055073_1111055078 17 Left 1111055073 13:82938430-82938452 CCTTGCTACCTCTCTGGTTGTCT No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data
1111055072_1111055078 20 Left 1111055072 13:82938427-82938449 CCACCTTGCTACCTCTCTGGTTG No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data
1111055074_1111055078 9 Left 1111055074 13:82938438-82938460 CCTCTCTGGTTGTCTGCCTAACC No data
Right 1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111055078 Original CRISPR TTGGATGCAAAACAAGAACA TGG Intergenic
No off target data available for this crispr