ID: 1111058996

View in Genome Browser
Species Human (GRCh38)
Location 13:82987763-82987785
Sequence TTTCATGGCAATGGTTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111058994_1111058996 -9 Left 1111058994 13:82987749-82987771 CCTTTCTCTTCAGTTTTCATGGC No data
Right 1111058996 13:82987763-82987785 TTTCATGGCAATGGTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111058996 Original CRISPR TTTCATGGCAATGGTTTGCC TGG Intergenic
No off target data available for this crispr