ID: 1111080776

View in Genome Browser
Species Human (GRCh38)
Location 13:83304328-83304350
Sequence ATACTTTTTTTGAAGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111080775_1111080776 25 Left 1111080775 13:83304280-83304302 CCACATCATAAATAAGTATAATC No data
Right 1111080776 13:83304328-83304350 ATACTTTTTTTGAAGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111080776 Original CRISPR ATACTTTTTTTGAAGAAACA TGG Intergenic
No off target data available for this crispr