ID: 1111090019

View in Genome Browser
Species Human (GRCh38)
Location 13:83433248-83433270
Sequence ATATGGTTTCTGGCCAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111090015_1111090019 23 Left 1111090015 13:83433202-83433224 CCTGATTATAAGTTATGTTTTAT No data
Right 1111090019 13:83433248-83433270 ATATGGTTTCTGGCCAAAGATGG No data
1111090016_1111090019 -1 Left 1111090016 13:83433226-83433248 CCAATTTTATATCTATATTTAGA No data
Right 1111090019 13:83433248-83433270 ATATGGTTTCTGGCCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111090019 Original CRISPR ATATGGTTTCTGGCCAAAGA TGG Intergenic
No off target data available for this crispr