ID: 1111092147

View in Genome Browser
Species Human (GRCh38)
Location 13:83461932-83461954
Sequence GTCCTGGTTACCACTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111092147_1111092155 20 Left 1111092147 13:83461932-83461954 CCCCAGGGAGTGGTAACCAGGAC No data
Right 1111092155 13:83461975-83461997 GCTGTTTGAGCTCCTTGGGTAGG No data
1111092147_1111092157 22 Left 1111092147 13:83461932-83461954 CCCCAGGGAGTGGTAACCAGGAC No data
Right 1111092157 13:83461977-83461999 TGTTTGAGCTCCTTGGGTAGGGG No data
1111092147_1111092154 16 Left 1111092147 13:83461932-83461954 CCCCAGGGAGTGGTAACCAGGAC No data
Right 1111092154 13:83461971-83461993 CTAAGCTGTTTGAGCTCCTTGGG No data
1111092147_1111092156 21 Left 1111092147 13:83461932-83461954 CCCCAGGGAGTGGTAACCAGGAC No data
Right 1111092156 13:83461976-83461998 CTGTTTGAGCTCCTTGGGTAGGG No data
1111092147_1111092153 15 Left 1111092147 13:83461932-83461954 CCCCAGGGAGTGGTAACCAGGAC No data
Right 1111092153 13:83461970-83461992 GCTAAGCTGTTTGAGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111092147 Original CRISPR GTCCTGGTTACCACTCCCTG GGG (reversed) Intergenic
No off target data available for this crispr