ID: 1111095634

View in Genome Browser
Species Human (GRCh38)
Location 13:83511461-83511483
Sequence CCCTCTAGGTTGTTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111095629_1111095634 14 Left 1111095629 13:83511424-83511446 CCATAGACTTTTATTGATACAGA No data
Right 1111095634 13:83511461-83511483 CCCTCTAGGTTGTTTCTCACAGG No data
1111095628_1111095634 29 Left 1111095628 13:83511409-83511431 CCTCTTAACAAATCACCATAGAC No data
Right 1111095634 13:83511461-83511483 CCCTCTAGGTTGTTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111095634 Original CRISPR CCCTCTAGGTTGTTTCTCAC AGG Intergenic
No off target data available for this crispr