ID: 1111096219

View in Genome Browser
Species Human (GRCh38)
Location 13:83518502-83518524
Sequence GTATTATTCACAACTTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111096219_1111096220 0 Left 1111096219 13:83518502-83518524 CCAGGTAAAGTTGTGAATAATAC No data
Right 1111096220 13:83518525-83518547 AATTTATCAATTTCAAAAAATGG No data
1111096219_1111096221 15 Left 1111096219 13:83518502-83518524 CCAGGTAAAGTTGTGAATAATAC No data
Right 1111096221 13:83518540-83518562 AAAAATGGAAAAGAAAAATGAGG No data
1111096219_1111096223 19 Left 1111096219 13:83518502-83518524 CCAGGTAAAGTTGTGAATAATAC No data
Right 1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG No data
1111096219_1111096222 18 Left 1111096219 13:83518502-83518524 CCAGGTAAAGTTGTGAATAATAC No data
Right 1111096222 13:83518543-83518565 AATGGAAAAGAAAAATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111096219 Original CRISPR GTATTATTCACAACTTTACC TGG (reversed) Intergenic
No off target data available for this crispr