ID: 1111096223

View in Genome Browser
Species Human (GRCh38)
Location 13:83518544-83518566
Sequence ATGGAAAAGAAAAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111096219_1111096223 19 Left 1111096219 13:83518502-83518524 CCAGGTAAAGTTGTGAATAATAC No data
Right 1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111096223 Original CRISPR ATGGAAAAGAAAAATGAGGA GGG Intergenic
No off target data available for this crispr