ID: 1111105649

View in Genome Browser
Species Human (GRCh38)
Location 13:83642420-83642442
Sequence GGGTAAATACAGATATTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111105645_1111105649 4 Left 1111105645 13:83642393-83642415 CCTAGATATACTAGGGGTACAGG No data
Right 1111105649 13:83642420-83642442 GGGTAAATACAGATATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111105649 Original CRISPR GGGTAAATACAGATATTCCA AGG Intergenic
No off target data available for this crispr