ID: 1111118707

View in Genome Browser
Species Human (GRCh38)
Location 13:83816864-83816886
Sequence ACAGCCAAAAAGAGTAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111118704_1111118707 26 Left 1111118704 13:83816815-83816837 CCAGGCAGTTTTAACTGAAATAT No data
Right 1111118707 13:83816864-83816886 ACAGCCAAAAAGAGTAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111118707 Original CRISPR ACAGCCAAAAAGAGTAAAGA GGG Intergenic
No off target data available for this crispr