ID: 1111125184

View in Genome Browser
Species Human (GRCh38)
Location 13:83906141-83906163
Sequence TGGGAGGGCAGTGGTTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111125184_1111125197 9 Left 1111125184 13:83906141-83906163 CCTGTCCAACCACTGCCCTCCCA No data
Right 1111125197 13:83906173-83906195 CCAGGCTTCCGTCACATACTAGG No data
1111125184_1111125189 -9 Left 1111125184 13:83906141-83906163 CCTGTCCAACCACTGCCCTCCCA No data
Right 1111125189 13:83906155-83906177 GCCCTCCCAGGGCCTCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111125184 Original CRISPR TGGGAGGGCAGTGGTTGGAC AGG (reversed) Intergenic