ID: 1111131441

View in Genome Browser
Species Human (GRCh38)
Location 13:83982034-83982056
Sequence AAAAATAGGGTGTACGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111131441_1111131445 19 Left 1111131441 13:83982034-83982056 CCTGTTACGTACACCCTATTTTT No data
Right 1111131445 13:83982076-83982098 TGCAAAAATATTTACATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111131441 Original CRISPR AAAAATAGGGTGTACGTAAC AGG (reversed) Intergenic
No off target data available for this crispr