ID: 1111135644

View in Genome Browser
Species Human (GRCh38)
Location 13:84039144-84039166
Sequence AGTCATGTGTCCAGAGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111135642_1111135644 22 Left 1111135642 13:84039099-84039121 CCTCATAAAAGCATCATTGCTAC No data
Right 1111135644 13:84039144-84039166 AGTCATGTGTCCAGAGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111135644 Original CRISPR AGTCATGTGTCCAGAGTTGT AGG Intergenic
No off target data available for this crispr