ID: 1111137556

View in Genome Browser
Species Human (GRCh38)
Location 13:84068196-84068218
Sequence GTCTCGCTTTGTTGAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111137556_1111137559 30 Left 1111137556 13:84068196-84068218 CCAGCCTCTCAACAAAGCGAGAC No data
Right 1111137559 13:84068249-84068271 CTTCATATCTGCCAACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111137556 Original CRISPR GTCTCGCTTTGTTGAGAGGC TGG (reversed) Intergenic