ID: 1111140334

View in Genome Browser
Species Human (GRCh38)
Location 13:84109785-84109807
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111140334_1111140335 17 Left 1111140334 13:84109785-84109807 CCTAGTTTGATGTGTTGATCTTG No data
Right 1111140335 13:84109825-84109847 AGAATCCTATAATATAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111140334 Original CRISPR CAAGATCAACACATCAAACT AGG (reversed) Intergenic
No off target data available for this crispr