ID: 1111141310

View in Genome Browser
Species Human (GRCh38)
Location 13:84122821-84122843
Sequence GATATAATGAGAGCAAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111141310_1111141311 -7 Left 1111141310 13:84122821-84122843 CCAGAGTTTGCTCTCATTATATC No data
Right 1111141311 13:84122837-84122859 TTATATCTTTGTATTCTGATAGG No data
1111141310_1111141312 12 Left 1111141310 13:84122821-84122843 CCAGAGTTTGCTCTCATTATATC No data
Right 1111141312 13:84122856-84122878 TAGGTATAATTTCACTGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111141310 Original CRISPR GATATAATGAGAGCAAACTC TGG (reversed) Intergenic
No off target data available for this crispr