ID: 1111143266

View in Genome Browser
Species Human (GRCh38)
Location 13:84150085-84150107
Sequence TTGGGACTACTGTTGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111143266_1111143274 7 Left 1111143266 13:84150085-84150107 CCTCCCCCCAACAGTAGTCCCAA No data
Right 1111143274 13:84150115-84150137 GTGTTTTGAGCTTTATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111143266 Original CRISPR TTGGGACTACTGTTGGGGGG AGG (reversed) Intergenic
No off target data available for this crispr