ID: 1111143268

View in Genome Browser
Species Human (GRCh38)
Location 13:84150089-84150111
Sequence AAACTTGGGACTACTGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111143268_1111143274 3 Left 1111143268 13:84150089-84150111 CCCCCAACAGTAGTCCCAAGTTT No data
Right 1111143274 13:84150115-84150137 GTGTTTTGAGCTTTATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111143268 Original CRISPR AAACTTGGGACTACTGTTGG GGG (reversed) Intergenic
No off target data available for this crispr